lrrtm4l1

Ensembl ID:
ENSDARG00000080015
ZFIN ID:
ZDB-GENE-080327-15
Description:
cDNA, clone cssl:d0341 [Source:UniProtKB/TrEMBL;Acc:A8BB40]
Human Orthologue:
LRRTM4
Human Description:
leucine rich repeat transmembrane neuronal 4 [Source:HGNC Symbol;Acc:19411]
Mouse Orthologue:
Lrrtm4
Mouse Description:
leucine rich repeat transmembrane neuronal 4 Gene [Source:MGI Symbol;Acc:MGI:2389180]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu3329 Nonsense Available for shipment Available now
sa11361 Nonsense Available for shipment Available now
sa21708 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu3329
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113737 Nonsense 187 571 2 3
ENSDART00000141364 Nonsense 187 456 2 2
Genomic Location (Zv9):
Chromosome 10 (position 19369203)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19381549
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCGTGCGTTTTTGGAGTGCCGAAGCTTGGAGTTTCTAGACTTGGGCTA[T/G]AATCGGCTTCGGGTTCTAACTCGCACAGCATTCCTAGGTTTGTCTCGACT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa11361
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113737 Nonsense 229 571 2 3
ENSDART00000141364 Nonsense 229 456 2 2
Genomic Location (Zv9):
Chromosome 10 (position 19369327)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19381673
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAGTTTTCACGAATCAACTTCTTTCTCTTTCCACGCCTTGCCAACCTT[C/T]GAGCCCTTTACCTACAGTGGAACCGTATTCGAGCTGTCAACCAAGGCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21708
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113737 Nonsense 357 571 2 3
ENSDART00000141364 Nonsense 357 456 2 2
Genomic Location (Zv9):
Chromosome 10 (position 19369713)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19382059
KASP Assay ID:
2260-3115.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTTCAAGGGGAAAAAGTCATTGAGGCTTCAAAGAACTACATTGACTG[T/A]GATGATTATGAAATTACCGCTCAATCTCCTTTGTATCTGCAGACGTTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link