adh5

Ensembl ID:
ENSDARG00000080010
ZFIN ID:
ZDB-GENE-011003-1
Description:
alcohol dehydrogenase class-3 [Source:RefSeq peptide;Acc:NP_571924]
Human Orthologue:
ADH5
Human Description:
alcohol dehydrogenase 5 (class III), chi polypeptide [Source:HGNC Symbol;Acc:253]
Mouse Orthologue:
Adh5
Mouse Description:
alcohol dehydrogenase 5 (class III), chi polypeptide Gene [Source:MGI Symbol;Acc:MGI:87929]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4573 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4573
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108825 Essential Splice Site 87 376 3 9
Genomic Location:
Chromosome 14 (position 45841401)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAGGCACTGTTGAGAGTGTTGGTGAAGGGGTCACCAAATTCAAACCAG[G/A]CACGTCAAAATAGACTATTTACCCTGACTCGAATAACACAGAGACAGGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ueg38ple