BAHCC1

Ensembl ID:
ENSDARG00000080009
Description:
BAH domain and coiled-coil containing 1 [Source:HGNC Symbol;Acc:29279]
Human Orthologue:
BAHCC1
Human Description:
BAH domain and coiled-coil containing 1 [Source:HGNC Symbol;Acc:29279]
Mouse Orthologue:
Bahcc1
Mouse Description:
BAH domain and coiled-coil containing 1 Gene [Source:MGI Symbol;Acc:MGI:2679272]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24918 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15411 Nonsense Available for shipment Available now
sa35350 Nonsense Available for shipment Available now
sa42078 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42079 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35351 Nonsense Mutation detected in F1 DNA During 2016
sa874 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110615 Essential Splice Site 101 2554 3 37
Genomic Location (Zv9):
Chromosome 12 (position 36705984)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34516441
KASP Assay ID:
554-7446.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTACAAAACTTAGACATGCAAAACTATGTCTAAATTTGATTTCTTTCC[T/C]TAGATTTCTATCTACGAAGCCTCCCATCGCAGCCCCACCTTCTCTCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15411
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110615 Nonsense 498 2554 5 37
Genomic Location (Zv9):
Chromosome 12 (position 36707280)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34515145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGAGCCACRGAGGTTGAGTGTACTCAGAAAAGCAGCCAGAGGGTTGCA[C/T]GAATACGTCATCAGCAGCACAGGGCTAGCACTGGTGGACAGGGTCCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35350
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110615 Nonsense 890 2554 10 37
Genomic Location (Zv9):
Chromosome 12 (position 36713440)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34508985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTACGGAGCCCGAGGGCCCACCTCACACATGCAGCATCCCGCAGTCTA[T/A]TCCCGCTCCCAGTTTCTACGGCAACAGGAACTCTACGCGCTGCAGCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42078
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110615 Essential Splice Site 1577 2554 23 37
Genomic Location (Zv9):
Chromosome 12 (position 36745516)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34476909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAGTCCAGTCAAGATGTCAATGCATTCAATCGATCCATCATTTTCACA[G/T]AGGAGGAAGATGACGGCATCTACGACAGCGAGGAAGGGGCAGAGGGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42079
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110615 Essential Splice Site 1851 2554 29 37
Genomic Location (Zv9):
Chromosome 12 (position 36749397)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34473028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAGTTACTGTATGCTGCTTATGTACATACATTGGACCTGCCTGATATG[T/A]AAGAGAACCAGACCTGCATTATGGATGGATGGATGTATAAGTAGCTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35351
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110615 Nonsense 2165 2554 34 37
Genomic Location (Zv9):
Chromosome 12 (position 36756795)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34465630
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAGACTAAAAATGGAAAAGCATTGTTGCTTCTTGGGAACCCAGAGCTA[C/T]AAAGAAGTGGACGAATGGAAAAGGGCTTTGGAGCCAAAGGTATTGGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa874
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110615 Nonsense 2188 2554 34 37
Genomic Location (Zv9):
Chromosome 12 (position 36756866)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34465559
KASP Assay ID:
554-0776.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGGCTTTGGAGCCAAAGGTATTGGAGAGCTGACCTCAACAATGGGCTA[T/A]TCCCAGTCTGTTCTTCTTGTCAAAGATGCCAAAAGGAACAGTTGCCATCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link