BAHCC1

Ensembl ID:
ENSDARG00000080009
Description:
BAH domain and coiled-coil containing 1 [Source:HGNC Symbol;Acc:29279]
Human Orthologue:
BAHCC1
Human Description:
BAH domain and coiled-coil containing 1 [Source:HGNC Symbol;Acc:29279]
Mouse Orthologue:
Bahcc1
Mouse Description:
BAH domain and coiled-coil containing 1 Gene [Source:MGI Symbol;Acc:MGI:2679272]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24918 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15411 Nonsense Available for shipment Available now
sa4477 Essential Splice Site Mutation detected in F1 DNA During 2014
sa874 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110615 Essential Splice Site 101 2554 3 37
Genomic Location:
Chromosome 12 (position 36705984)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTACAAAACTTAGACATGCAAAACTATGTCTAAATTTGATTTCTTTCC[T/C]TAGATTTCTATCTACGAAGCCTCCCATCGCAGCCCCACCTTCTCTCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15411
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110615 Nonsense 498 2554 5 37
Genomic Location:
Chromosome 12 (position 36707280)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGAGCCACRGAGGTTGAGTGTACTCAGAAAAGCAGCCAGAGGGTTGCA[C/T]GAATACGTCATCAGCAGCACAGGGCTAGCACTGGTGGACAGGGTCCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4477
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110615 Essential Splice Site 2002 2554 33 37
Genomic Location:
Chromosome 12 (position 36755466)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTCTAACACAGAGCCAAGGAAGAGTGCCRTTAAAGCCAAGCCAGGTG[C/T]GAGATGACAGCTGCATTATCCATATTCTCACGGTTTCCCAAACTGATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa874
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110615 Nonsense 2188 2554 34 37
Genomic Location:
Chromosome 12 (position 36756866)
KASP Assay ID:
554-0776.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGGCTTTGGAGCCAAAGGTATTGGAGAGCTGACCTCAACAATGGGCTA[T/A]TCCCAGTCTGTTCTTCTTGTCAAAGATGCCAAAAGGAACAGTTGCCATCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cipp5qfs