tmem41b

Ensembl ID:
ENSDARG00000080006
ZFIN ID:
ZDB-GENE-061215-138
Description:
Transmembrane protein 41B [Source:UniProtKB/Swiss-Prot;Acc:A1A5V7]
Human Orthologue:
TMEM41B
Human Description:
transmembrane protein 41B [Source:HGNC Symbol;Acc:28948]
Mouse Orthologue:
Tmem41b
Mouse Description:
transmembrane protein 41B Gene [Source:MGI Symbol;Acc:MGI:1289225]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25375 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25375
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098277 Nonsense 280 282 7 8
ENSDART00000110614 Nonsense 280 282 7 7
Genomic Location:
Chromosome 7 (position 66966165)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCCGTCGTCTCCATCCTGCCGGTTTGCTTTCAGAAGAAACTCCAGCAA[A/T]AGCTCGAGTAGAGAGAGGTCTCCCACCCCTGCTTGATTCAACTCAGGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/014w1w0d