si:dkey-178e17.1

Ensembl ID:
ENSDARG00000080000
ZFIN ID:
ZDB-GENE-081104-41
Human Orthologue:
SLC25A1
Human Description:
solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 [Source:HGNC Symbol;
Mouse Orthologue:
Slc25a1
Mouse Description:
solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 Gene [Source:MGI Sym

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41099 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109734 Nonsense 181 216 6 6
ENSDART00000131602 Nonsense 176 211 6 6
Genomic Location (Zv9):
Chromosome 8 (position 2129514)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 1941896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGGGGTCTGGTGCAGGTTTTA[T/G]AAAGGCACCGTGCCGCGTTTGGGTCGAGTGTGTCTGGATGTGGCCATCGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link