LOC100330644

Ensembl ID:
ENSDARG00000079999
Human Orthologue:
RSBN1
Human Description:
round spermatid basic protein 1 [Source:HGNC Symbol;Acc:25642]
Mouse Orthologue:
Rsbn1
Mouse Description:
rosbin, round spermatid basic protein 1 Gene [Source:MGI Symbol;Acc:MGI:2444993]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30473 Nonsense Mutation detected in F1 DNA During 2017
sa39519 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30473
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111538 Nonsense 261 624 2 6
Genomic Location (Zv9):
Chromosome Zv9_NA661 (position 4480)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26299408
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCGTGGCAAGAAGTTACGAATGCACCATAAGGAGGTCCAGACGGTGTG[T/A]TCAGGAGACACTCCACCGCTTTCTGAAGACCCTGTGGGACATGCGTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39519
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111538 Nonsense 386 624 2 6
Genomic Location (Zv9):
Chromosome Zv9_NA661 (position 4854)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26299034
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACGCGCTCGCTGTGGTGCATGGAGCAGCTGCATACCTGCCCGACTTCT[T/A]GGACTATTTTGCCTTCAATTTCCCAAACACACCTGTCAAGGTGGAAATCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link