LOC100333359

Ensembl ID:
ENSDARG00000079997
Human Orthologue:
C20orf26
Human Description:
chromosome 20 open reading frame 26 [Source:HGNC Symbol;Acc:15872]
Mouse Orthologue:
4930529M08Rik
Mouse Description:
RIKEN cDNA 4930529M08 gene Gene [Source:MGI Symbol;Acc:MGI:1926024]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30721 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30721
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115217 Nonsense 479 570 9 10
Genomic Location (Zv9):
Chromosome 20 (position 48794008)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 48682654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAAAGACGTATAATTTCCTCTTTTTCGCAGTTATTTTAAAGAGAACTG[G/A]TGCTTGGCTCTGTATCATGATCGCTTTGCTGATTTTGAACAAGAAGTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link