ENSDARG00000079994

Ensembl ID:
ENSDARG00000079994

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16339 Essential Splice Site Available for shipment Available now
sa17891 Nonsense Available for shipment Available now
sa12723 Nonsense Available for shipment Available now
sa24619 Essential Splice Site Available for shipment Available now
sa17381 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16339
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112789 Essential Splice Site 63 1666 2 21
Genomic Location (Zv9):
Chromosome 25 (position 11542387)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 11078940
KASP Assay ID:
2261-9441.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCYAGCACACTRAAGATCAGCCATGTCACGCTGCAGGCCGTCTGTCCAGG[T/G]CAGAAAATATCAWTAACTGTATAGTTACAGTACAAAAATTGTATGTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17891
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112789 Nonsense 549 1666 6 21
Genomic Location (Zv9):
Chromosome 25 (position 11577794)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 11114347
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGCCCCAGTTGCCTACACAATGCYYAGAGGGAACAGATGAAGCTAART[T/A]GACTTTAATTCAGGTAAATTCTGAAGTTAYTTTGTCTRTACKAAGCGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12723
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112789 Nonsense 1193 1666 10 21
Genomic Location (Zv9):
Chromosome 25 (position 11618283)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 11154836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGCTGAGGACAGCATTACCATCACCAGTGGCGTGTCCATGTCCTATT[C/A]GTCCTCCACAGATGACTCTTCCAGCTTGGGAACCMCTTGCGCCACCCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24619
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112789 Essential Splice Site 1416 1666 14 21
Genomic Location (Zv9):
Chromosome 25 (position 11629646)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 11165469
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACCAAATCTGTGTCCATGGTGGCCATCAGTCAGAAGGACCTGGACGG[T/C]GAGTTGAAATCATCTTCTCTGTTTTTCTGTCCTCCGTCTTGTTGTGTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17381
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112789 Essential Splice Site 1610 1666 20 21
Genomic Location (Zv9):
Chromosome 25 (position 11646026)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 11181837
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGTTACAGATTCTGCCTCGACGCCTAGTGTCAYCCTCAGAAGTAAAAG[T/A]AAGTTTCCCTYATACTCATTTGATGTATTCTTCTCTATTTGCATGTKTYA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link