LOC559077

Ensembl ID:
ENSDARG00000079992
Human Orthologue:
SENP6
Human Description:
SUMO1/sentrin specific peptidase 6 [Source:HGNC Symbol;Acc:20944]
Mouse Orthologue:
Senp6
Mouse Description:
SUMO/sentrin specific peptidase 6 Gene [Source:MGI Symbol;Acc:MGI:1922075]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7836 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42977 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23133 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7836
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112257 Essential Splice Site 74 565 3 16
Genomic Location:
Chromosome 17 (position 37026920)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTTTATTTACAGTTTACAGTGGATTGCATTGAGATCAGTTCTGAAGG[T/A]AAGCCARACATTAAGGTTTTWAATAATTCWGATGTTTTATTGATKAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42977
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112257 Essential Splice Site 284 565 8 16
Genomic Location:
Chromosome 17 (position 37022919)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATGAAGGGGAATTTTTAAACGATGTGATAGTAGATTTCTATCTAAGG[T/G]TAGATTTGTAGAAGTGGCTATATATTTTAGTCTGTTGTTTCTGTAATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23133
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112257 Nonsense 541 565 16 16
Genomic Location:
Chromosome 17 (position 37017869)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCAGGACCCACCTCAAGCTTTTCATCACAACATGGACTTGAAAGGCTG[G/A]TTTTCACAAAGAACAGTAAAAAGGAAGAGGTTGCAAATCAAAGAGCTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link