nrip2

Ensembl ID:
ENSDARG00000079985
ZFIN ID:
ZDB-GENE-030131-9425
Description:
nuclear receptor-interacting protein 2 [Source:RefSeq peptide;Acc:NP_001116987]
Human Orthologues:
NRIP2, NRIP3
Human Descriptions:
nuclear receptor interacting protein 2 [Source:HGNC Symbol;Acc:23078]
nuclear receptor interacting protein 3 [Source:HGNC Symbol;Acc:1167]
Mouse Orthologues:
Nrip2, Nrip3
Mouse Descriptions:
nuclear receptor interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1891884]
nuclear receptor interacting protein 3 Gene [Source:MGI Symbol;Acc:MGI:1925843]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40267 Nonsense Mutation detected in F1 DNA During 2017
sa5735 Essential Splice Site F2 line generated During 2017
sa2164 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa40267
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108814 Nonsense 143 296 2 6
Genomic Location (Zv9):
Chromosome 4 (position 16664436)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17607276
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAGATGAAGGAGACAGCAGTGACGCAGGAGGAAAGACTGACTCCAAA[C/T]AGAAAGAGCAGAGGAAGAAAGAGCTCAAGGAGGGAGAAAGAGCAGCCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5735
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108814 Essential Splice Site 169 296 3 6
ENSDART00000108814 Essential Splice Site 169 296 3 6
Genomic Location (Zv9):
Chromosome 4 (position 16649511)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17592351
KASP Assay ID:
554-3097.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATAATCAAGGATTTCATTTTGAGTGAAGAACCAAATGTTTATTTTGCA[G/A]TGTGGAGATGCAGAGGTGATGCTATCCATAAACACAGGATGCCAACACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2164
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108814 Essential Splice Site 169 296 3 6
ENSDART00000108814 Essential Splice Site 169 296 3 6
Genomic Location (Zv9):
Chromosome 4 (position 16649511)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17592351
KASP Assay ID:
554-3097.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATAATCAAGGATTTCATTTTGAGTGAAGAACCAAATGTTTATTTTGCA[G/A]TGTGGAGATGCAGAGGTGATGCTATCCATAAACACAGGATGCCAACACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link