NHS (1 of 2)

Ensembl ID:
ENSDARG00000079977
Description:
Nance-Horan syndrome (congenital cataracts and dental anomalies) [Source:HGNC Symbol;Acc:7820]
Human Orthologue:
NHS
Human Description:
Nance-Horan syndrome (congenital cataracts and dental anomalies) [Source:HGNC Symbol;Acc:7820]
Mouse Orthologue:
Nhs
Mouse Description:
Nance-Horan syndrome (human) Gene [Source:MGI Symbol;Acc:MGI:2684894]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41866 Essential Splice Site Mutation detected in F1 DNA During 2017
sa8742 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41866
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112254 Essential Splice Site 184 1431 4 10
Genomic Location (Zv9):
Chromosome 11 (position 30957702)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29835064
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGACTCTCAAGTGATTTCATCCTGTATCATTCCAATAAATGTTTCGGG[T/C]AAAGCAACTACTTCAGATTCAGTACAGACTAAAAATTTCAAATATGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8742
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112254 Nonsense 929 1431 7 10
Genomic Location (Zv9):
Chromosome 11 (position 30960261)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29837623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAAKCACTTTCCTCACAGAAATCAAATGCACATCCTCCACCAGAATAAG[C/T]AGAAAGCTGCCATAGCAGCAGCTGCTGCAGCAGAAGCTCGCAGTGCAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link