LOC571865

Ensembl ID:
ENSDARG00000079972
Human Orthologue:
NFATC2
Human Description:
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 [Source:HGNC Symbol;Acc:77
Mouse Orthologue:
Nfatc2
Mouse Description:
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 Gene [Source:MGI Symbol;Ac

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20827 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40804 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20827
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113805 Essential Splice Site 439 792 4 10
Genomic Location (Zv9):
Chromosome 6 (position 55215483)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 55231796
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAGATCCTTGAGGTGCCGATGGAACCCAAGGAGAACATGAGAGCTGTG[T/A]AAGAACATTATTATTATCACATTCAGTTCAATTCAGGTTTATTTGTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40804
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113805 Nonsense 483 792 5 10
Genomic Location (Zv9):
Chromosome 6 (position 55214239)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 55230552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCCGTGTGAGATTGGTCTTCCGTGTCCATATTCCTCAACCTGGAGGA[C/T]AGTGGCTTTCTCTCCAAGTGGCCTCGCAGACCATTGAATGCTGTATGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link