LOC100330448

Ensembl ID:
ENSDARG00000079969
Human Orthologue:
C10orf2
Human Description:
chromosome 10 open reading frame 2 [Source:HGNC Symbol;Acc:1160]
Mouse Orthologue:
Peo1
Mouse Description:
progressive external ophthalmoplegia 1 (human) Gene [Source:MGI Symbol;Acc:MGI:2137410]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22147 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22147
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109494 Nonsense 116 660 1 6
Genomic Location:
Chromosome 12 (position 35308840)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAAAACTTCTCGCTCTTCATTGATAAAACCACCGGACAGTTTTTATGC[A/T]AGGACACTTTAGTAGAAGGAAACTGGGAGGACTTCCAGGACTGCCTTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3afymv5p