prkd3

Ensembl ID:
ENSDARG00000079967
Human Orthologue:
PRKD3
Human Description:
protein kinase D3 [Source:HGNC Symbol;Acc:9408]
Mouse Orthologue:
Prkd3
Mouse Description:
protein kinase D3 Gene [Source:MGI Symbol;Acc:MGI:1922542]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10098 Nonsense Available for shipment Available now
sa31014 Nonsense Mutation detected in F1 DNA During 2017
sa36491 Nonsense Mutation detected in F1 DNA During 2017
sa15360 Essential Splice Site Available for shipment Available now
sa16906 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10098
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112765 Nonsense 122 891 2 18
Genomic Location (Zv9):
Chromosome 17 (position 42521539)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 42420279
KASP Assay ID:
2261-1444.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAGATCTTGCTTTTCCGGCATGATCTTAACTCAGACAACATCCTCCAA[C/T]GATTGACATCAGCAGAGGAGATCCATGAGGGAGATCTGATCGAGGTCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31014
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112765 Nonsense 142 891 3 18
Genomic Location (Zv9):
Chromosome 17 (position 42492036)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 42390776
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCCATTCTTCTACTGAGTTGTCCTTTAAGTTGCGTTTTGATTGCAGCT[C/T]AAGCTACAGTCGAAGATTTCCAGATACGACCTCATGCGCTGTACGTCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36491
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112765 Nonsense 190 891 4 18
Genomic Location (Zv9):
Chromosome 17 (position 42483426)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 42382166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGACACTAAAGCCTTCTCTGTGGATTTGTAGGATGTGGCCTGAACTA[T/G]CACAAACGATGTGCCTTTAAAATCCCCAACAACTGTAGCGGTGTGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15360
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112765 Essential Splice Site 325 891 6 18
Genomic Location (Zv9):
Chromosome 17 (position 42470476)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 42369216
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGATGTGCTTCAAAGGTACCAAAAGACTGTCTTGGAGTCTTCAATGGAG[G/A]TATGGTTTTAGGTTTAGCAATCAGCTAAATGGTAAAAATGCACTGCTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16906
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112765 Nonsense 575 891 12 18
Genomic Location (Zv9):
Chromosome 17 (position 42458059)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 42356799
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAATCTTCTGCCATGCCTTCTTCTGTGTTTAGGATATCAGCTCAATCTA[T/G]CAGATCTTTGCTGAYGAAGTGTTGGGCTCTGGACAGTTYGGCATCGTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link