dlx2a

Ensembl ID:
ENSDARG00000079964
ZFIN ID:
ZDB-GENE-980526-212
Description:
Homeobox protein Dlx2a [Source:UniProtKB/Swiss-Prot;Acc:P50574]
Human Orthologue:
DLX2
Human Description:
distal-less homeobox 2 [Source:HGNC Symbol;Acc:2915]
Mouse Orthologue:
Dlx2
Mouse Description:
distal-less homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:94902]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11175 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11175
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111386 Nonsense 59 271 1 3
Genomic Location (Zv9):
Chromosome 9 (position 3396837)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3428858
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCTACTACAATAATAATAACCAGCWGTGCGCTGGCTCTCCGTACGGC[C/T]AGATCAGCTCTTAYCAGTACCAGAACAACAGCATGAACAGCGTCCAGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link