doc2d

Ensembl ID:
ENSDARG00000079962
ZFIN ID:
ZDB-GENE-081104-451
Description:
hypothetical protein LOC100002795 [Source:RefSeq peptide;Acc:NP_001122026]
Mouse Orthologue:
Doc2g
Mouse Description:
double C2, gamma Gene [Source:MGI Symbol;Acc:MGI:1926250]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41143 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41143
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092672 Nonsense 257 429 5 10
ENSDART00000143784 Nonsense 257 429 6 11

The following transcripts of ENSDARG00000079962 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 14427230)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13872574
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGTCAGGGTGGCTCTCAAGAAACTGAAGGAGGGAGAGAGCAAGAAATA[C/A]AACATGGGGCTTGAGAGAATCGCACAGGTGTGTGTGTGTGTGAGTGAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link