LOC100334424

Ensembl ID:
ENSDARG00000079957
Human Orthologues:
TCEB3, TCEB3B, TCEB3C, TCEB3CL
Human Descriptions:
transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A) [Source:HGNC Symbol;Acc:
transcription elongation factor B polypeptide 3B (elongin A2) [Source:HGNC Symbol;Acc:30771]
transcription elongation factor B polypeptide 3C (elongin A3) [Source:HGNC Symbol;Acc:24617]
transcription elongation factor B polypeptide 3C-like [Source:HGNC Symbol;Acc:31007]
Mouse Orthologue:
Tceb3
Mouse Description:
transcription elongation factor B (SIII), polypeptide 3 Gene [Source:MGI Symbol;Acc:MGI:1351315]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18370 Nonsense Available for shipment Available now
sa35400 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18370
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113692 Nonsense 333 587 5 11
Genomic Location (Zv9):
Chromosome 13 (position 2108647)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2325228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAMGTCCCTTTACCAATGAGTCTYCCTGAATGCGAGGATCTTTCTCAGTA[T/G]CAGTACTTCAGTGAAAAGAAAGGTGAGCGTTTTTATTTTTCWGTCYCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35400
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113692 Essential Splice Site 398 587 6 11
Genomic Location (Zv9):
Chromosome 13 (position 2106002)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2327873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACTCTGTACCAGCAGTGCATCCGAGCGCTGCAGAACAACATCGACTG[T/A]ACGTACAAAACACACCATGATGATCTTCAGCTCAATAATTTAAGAGTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link