olfcj1

Ensembl ID:
ENSDARG00000079954
ZFIN ID:
ZDB-GENE-060503-724
Description:
hypothetical protein LOC100005028 [Source:RefSeq peptide;Acc:NP_001103761]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22449 Nonsense Available for shipment Available now
sa17553 Nonsense Available for shipment Available now
sa35666 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22449
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004952 Nonsense 295 857 3 6
Genomic Location (Zv9):
Chromosome 14 (position 17921945)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33034210
KASP Assay ID:
2260-7408.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGATTAAAGAGCTTTATTACCAAAATGTAACTGGTTATCAGTGGGTT[G/T]GAAGTGAGGGTTGGATCACGTACAGATTTCTAGCAACTGCGATTAACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17553
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004952 Nonsense 470 857 4 6
Genomic Location (Zv9):
Chromosome 14 (position 17922544)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33034809
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTTTGACAAACATGGTGRCCCAGTTGCACGTTACACACTGGTTAATTG[G/A]CAGATGAGCTATGAAGGAATAATAACATTTGAATCCATTGGCTTGTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35666
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004952 Nonsense 667 857 6 6
Genomic Location (Zv9):
Chromosome 14 (position 17923369)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33035634
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCCTGTATGTTGCGTCACACAGCATTTGGGATCACTTTTGTGCTCTG[C/A]ATTTCCTGTGTTCTAGGTAAAACATTAGTTGTTTTAATGGCATTCAGGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link