ACVR2A (2 of 2)

Ensembl ID:
ENSDARG00000079944
Description:
activin A receptor, type IIA [Source:HGNC Symbol;Acc:173]
Human Orthologue:
ACVR2A
Human Description:
activin A receptor, type IIA [Source:HGNC Symbol;Acc:173]
Mouse Orthologue:
Acvr2a
Mouse Description:
activin receptor IIA Gene [Source:MGI Symbol;Acc:MGI:102806]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18285 Nonsense Available for shipment Available now
sa33786 Essential Splice Site Mutation detected in F1 DNA During 2016
sa12982 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18285
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025989 Nonsense 67 514 2 13
Genomic Location (Zv9):
Chromosome 6 (position 1460109)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 870506
KASP Assay ID:
2259-6979.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGAAAAGGACAAGCGRCGACACTGTTTCTCCACCTGGAAGAACCGCT[C/A]GGGRACCATCGAGATGGTSAAGCAGGGCTGCTGGCYGGACGATGTCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33786
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025989 Essential Splice Site 272 514 8 13
Genomic Location (Zv9):
Chromosome 6 (position 1450278)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 880337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGGAGTTGACATAGAGCTGTGGCTGATCACAACCTACCATGAGAAGG[T/C]ACACACACAGATATAAACACACATGCACAAACACACAAACATAGATACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12982
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025989 Nonsense 352 514 10 13
Genomic Location (Zv9):
Chromosome 6 (position 1449257)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 881358
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCCTGCATCGCTGACTTTGGCCTGGCGCTCAAGTTTGAAGCAGGAAAAK[C/A]AACAGGTGACACACACGGACAGGTAAATACCACATTTACATCTGCAGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link