ACVR2A (2 of 2)

Ensembl ID:
ENSDARG00000079944
Description:
activin A receptor, type IIA [Source:HGNC Symbol;Acc:173]
Human Orthologue:
ACVR2A
Human Description:
activin A receptor, type IIA [Source:HGNC Symbol;Acc:173]
Mouse Orthologue:
Acvr2a
Mouse Description:
activin receptor IIA Gene [Source:MGI Symbol;Acc:MGI:102806]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18285 Nonsense Available for shipment Available now
sa12982 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18285
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025989 Nonsense 67 514 2 13
Genomic Location:
Chromosome 6 (position 1460109)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGAAAAGGACAAGCGRCGACACTGTTTCTCCACCTGGAAGAACCGCT[C/A]GGGRACCATCGAGATGGTSAAGCAGGGCTGCTGGCYGGACGATGTCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12982
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025989 Nonsense 352 514 10 13
Genomic Location:
Chromosome 6 (position 1449257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCCTGCATCGCTGACTTTGGCCTGGCGCTCAAGTTTGAAGCAGGAAAAK[C/A]AACAGGTGACACACACGGACAGGTAAATACCACATTTACATCTGCAGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/raoskiq9