LOC100330960

Ensembl ID:
ENSDARG00000079942
Human Orthologue:
BDKRB2
Human Description:
bradykinin receptor B2 [Source:HGNC Symbol;Acc:1030]
Mouse Orthologue:
Bdkrb2
Mouse Description:
bradykinin receptor, beta 2 Gene [Source:MGI Symbol;Acc:MGI:102845]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22979 Nonsense Available for shipment Available now
sa42848 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22979
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113634 Nonsense 217 348 1 1
Genomic Location (Zv9):
Chromosome 17 (position 2641634)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2686939
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTAAACATCACAGCTTGCATTCTGGATTATCCAAATCCAAACATCGGTT[T/A]AATCTGTGACATTCTCCTCATGATAATCGGCTTCATCATACCGATTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42848
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113634 Nonsense 344 348 1 1
Genomic Location (Zv9):
Chromosome 17 (position 2641254)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2686559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTAATCGTGGGCAAGAACTTCAGGAAGAAGGTCAAAGAGCTGATGAAG[C/T]AACTTAATGAGAAGAAAGCGGATTCGACAAGCGGTTCTACGAGATCGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link