jmjd1c

Ensembl ID:
ENSDARG00000079939
Human Orthologue:
JMJD1C
Human Description:
jumonji domain containing 1C [Source:HGNC Symbol;Acc:12313]
Mouse Orthologue:
Jmjd1c
Mouse Description:
jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18109 Nonsense Available for shipment Available now
sa4452 Nonsense Mutation detected in F1 DNA During 2014
sa15925 Nonsense Available for shipment Available now
sa11812 Nonsense Available for shipment Available now
sa22034 Nonsense Mutation detected in F1 DNA During 2014
sa6235 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18109
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113148 Nonsense 1110 2557 11 27
Genomic Location:
Chromosome 12 (position 9378589)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCCAAAAGCCACGAGAAAGAGACAGAGMACTCTATGGCTGATCTGTA[C/A]AAGTACAAAMAYTCWGTATCTCAGTCTCTCCCTCAAACCAACTACTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4452
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113148 Nonsense 1560 2557 11 27
Genomic Location:
Chromosome 12 (position 9377241)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTMCACGCCCAGCAATCCWCYCAGCAAAGCCAGCCCGTTGCCCAATGGA[C/T]AGGCAGCGCAGGTGTGCCAGTCTAACYACCACAAACTCAAGAAAGCCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15925
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113148 Nonsense 1560 2557 11 27
Genomic Location:
Chromosome 12 (position 9377241)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTMCACGCCCAGCAATCCWCYCAGCAAAGCCAGCCCGTTGCCCAATGGA[C/T]AGGCAGCGCAGGTGTGCCAGTCTAACYACCACAAACTCAAGAAAGCCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11812
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113148 Nonsense 1677 2557 11 27
Genomic Location:
Chromosome 12 (position 9376890)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGGAGCAAAGGACTAARCGGCAACCCAAGCCCACTTACAAAAARAAG[C/T]AGAACGACATGCAGAAAAGGAAGGGAGACAATGAGAAGGAGGAGGACGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22034
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113148 Nonsense 1911 2557 15 27
Genomic Location:
Chromosome 12 (position 9366316)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTAATCCACCTTTTCTTATTCCGCAGATAAAGAGCTGTACGCCTG[G/A]TTGAAGTGTGTCAAGGGACAGCCTCATGATCACAAGCACCTGATGCCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6235
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113148 Nonsense 2222 2557 20 27
Genomic Location:
Chromosome 12 (position 9349641)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTAGCCTGTACTAGTCTCTGGGGTGCACCGAAGGCTCAACGCCAGCT[T/A]GTGGAAAGCAGAGTCCTTCAACCAAGAGTTTGCTGACCACCAGGGGGACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2rdip460