LOC568980

Ensembl ID:
ENSDARG00000079931
Human Orthologue:
SNX19
Human Description:
sorting nexin 19 [Source:HGNC Symbol;Acc:21532]
Mouse Orthologue:
Snx19
Mouse Description:
sorting nexin 19 Gene [Source:MGI Symbol;Acc:MGI:1921581]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2818 Nonsense F2 line generated During 2014
sa6369 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2818
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112024 Nonsense 46 956 1 11
Genomic Location:
Chromosome 15 (position 16462621)
KASP Assay ID:
554-3225.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGCCTGGATGGTCTTGTTCCACCTTCTGGTCAACGTTTGGCTCCTCTG[T/A]GTTTTCACAAGCCTCTTAGTGGTCTTAGGTGGTTGGCTGGGTTCTCAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6369
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112024 Nonsense 381 956 1 11
Genomic Location:
Chromosome 15 (position 16463625)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCGACTCYGATTTGGAATCTCCTCTGACGGACTTCAAGCGGGGCTCCK[T/A]GGAATCATTGRTTCTAATTGGYACAGAGGAAACCCTTTCAGAAAGACTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ms9vmyfz