LOC556494

Ensembl ID:
ENSDARG00000079925
Human Orthologue:
STK36
Human Description:
serine/threonine kinase 36 [Source:HGNC Symbol;Acc:17209]
Mouse Orthologue:
Stk36
Mouse Description:
serine/threonine kinase 36 (fused homolog, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920831]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31206 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31206
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109627 Essential Splice Site 21 288 2 6
Genomic Location (Zv9):
Chromosome 1 (position 25518060)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25858277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATCCGTTTCATACCAGACAATCCAAGTAAATCTCGCTGCTCTTTTTCT[G/A]TGTTTCAGGATTTGATCTGTCTGATTTTGAAGTAGACAACATGATTGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link