LOC556494

Ensembl ID:
ENSDARG00000079925
Human Orthologue:
STK36
Human Description:
serine/threonine kinase 36 [Source:HGNC Symbol;Acc:17209]
Mouse Orthologue:
Stk36
Mouse Description:
serine/threonine kinase 36 (fused homolog, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920831]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31206 Essential Splice Site Mutation detected in F1 DNA During 2016
sa5658 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa31206
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109627 Essential Splice Site 21 288 2 6
Genomic Location:
Chromosome 1 (position 25518060)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATCCGTTTCATACCAGACAATCCAAGTAAATCTCGCTGCTCTTTTTCT[G/A]TGTTTCAGGATTTGATCTGTCTGATTTTGAAGTAGACAACATGATTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5658
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109627 Essential Splice Site 72 288 3 6
Genomic Location:
Chromosome 1 (position 25518334)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCCCTGAAGTTTATGAACAAGCTTAAACAGGACCAATATCTCAACATT[G/A]TAAGTTGAATAATTCACACAACAGTGAAAATGATCCGACCATTTACTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link