POT1

Ensembl ID:
ENSDARG00000079915
Description:
protection of telomeres 1 homolog (S. pombe) [Source:HGNC Symbol;Acc:17284]
Human Orthologue:
POT1
Human Description:
protection of telomeres 1 homolog (S. pombe) [Source:HGNC Symbol;Acc:17284]
Mouse Orthologues:
Pot1a, Pot1b
Mouse Descriptions:
protection of telomeres 1A Gene [Source:MGI Symbol;Acc:MGI:2141503]
protection of telomeres 1B Gene [Source:MGI Symbol;Acc:MGI:1920086]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32537 Essential Splice Site Available for shipment Available now
sa8610 Nonsense Mutation detected in F1 DNA During 2017
sa39485 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32537
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115139 Essential Splice Site 67 773 2 20
Genomic Location (Zv9):
Chromosome 25 (position 28290976)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 26981070
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGTGCACAGAGAGATGGCTTGGAAATGCTTAGAGCTGAGATCAGAGG[T/C]GAGTTTCCCCATTTGAATGTAAATTCAAAGACAAAGATCATGAACAACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8610
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115139 Nonsense 561 773 15 20
Genomic Location (Zv9):
Chromosome 25 (position 28355214)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27045308
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGCAAACATATTTCTGGAATCTGCGAGAGATAACCAACCTTGTGATGAG[C/T]AGTGGGCTGCCACCTCATCWGCAAATTCTAGAGAACCTGGCAGAACYATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39485
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115139 Essential Splice Site 739 773 19 20
Genomic Location (Zv9):
Chromosome 25 (position 28358237)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27048331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATTCAGACAATCATGGACACAATTCAACCACCAGAAAGTAGTCTGGG[T/C]AAAGATGTCATTTACTATGTAACCGTTCAAATGTTCAAATTCGTTCTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link