RAPGEFL1

Ensembl ID:
ENSDARG00000079912
Description:
Rap guanine nucleotide exchange factor (GEF)-like 1 [Source:HGNC Symbol;Acc:17428]
Human Orthologue:
RAPGEFL1
Human Description:
Rap guanine nucleotide exchange factor (GEF)-like 1 [Source:HGNC Symbol;Acc:17428]
Mouse Orthologue:
Rapgefl1
Mouse Description:
Rap guanine nucleotide exchange factor (GEF)-like 1 Gene [Source:MGI Symbol;Acc:MGI:3611446]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31324 Essential Splice Site Available for shipment Available now
sa19993 Nonsense Available for shipment Available now
sa40059 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31324
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114723 Essential Splice Site 275 621 6 15
Genomic Location (Zv9):
Chromosome 3 (position 23648590)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23226801
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATTAACCTGTGTCAAATAGAAGCATTAAGTGTTTGTCCCATGTTTAA[G/A]TCTTTTGCAGGGTTTACACGCCAGATCATTCATACGTTACCATACGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19993
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114723 Nonsense 303 621 6 15
Genomic Location (Zv9):
Chromosome 3 (position 23648505)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23226716
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTACCATACGAAGCCGTCTTTCATGCCGGGTTGGGGAGATCTTGGCTT[T/A]GGTGAAAGAGAAGCTCCAGTACAGCGAGGACCAGCCAACCCAACCTGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40059
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114723 Nonsense 416 621 9 15
Genomic Location (Zv9):
Chromosome 3 (position 23643274)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23221485
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTTTGTTTGAACAGGTGGAGTTTGTGTGCTACGTGTTTCACGGTGAG[C/T]AGGCTCGCTGGCGCCCCCTAAACCTGGAGCTGATCTTGCAGCGCTGCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link