si:dkey-17e16.14

Ensembl ID:
ENSDARG00000079908
ZFIN ID:
ZDB-GENE-091118-118
Human Orthologue:
TMEM151A
Human Description:
transmembrane protein 151A [Source:HGNC Symbol;Acc:28497]
Mouse Orthologue:
Tmem151a
Mouse Description:
transmembrane protein 151A Gene [Source:MGI Symbol;Acc:MGI:2147713]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39330 Nonsense Mutation detected in F1 DNA During 2017
sa37318 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39330
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110705 Nonsense 252 486 1 3
ENSDART00000145091 Nonsense 306 598 1 1
Genomic Location (Zv9):
Chromosome 21 (position 25024854)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25608191
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTAAAAAATGTTGACTTTCGAGAACATATGCTAGCATTCCCTGACCCTT[T/A]ACACCCACCCTGGTACACCCGTCGTTGGGTATACTGGTTGGCCTCAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37318
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110705 Nonsense 445 486 3 3
ENSDART00000145091 Nonsense 548 598 1 1
Genomic Location (Zv9):
Chromosome 21 (position 25025579)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25608916
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGGGTGTGTTAGAGAGTGAAGGGCTAGAAGATGAAGATGTAGAGGAG[A/T]GAAGCCAGGAACAAGTGGAGGAGAGAGAAAATGTAGAGACCAGGGAGGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link