si:dkey-17e16.14

Ensembl ID:
ENSDARG00000079908
ZFIN ID:
ZDB-GENE-091118-118
Human Orthologue:
TMEM151A
Human Description:
transmembrane protein 151A [Source:HGNC Symbol;Acc:28497]
Mouse Orthologue:
Tmem151a
Mouse Description:
transmembrane protein 151A Gene [Source:MGI Symbol;Acc:MGI:2147713]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44969 Nonsense Mutation detected in F1 DNA During 2017
sa39330 Nonsense Mutation detected in F1 DNA During 2017
sa37318 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44969
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110705 Nonsense 144 486 1 3
ENSDART00000145091 Nonsense 198 598 1 1
Genomic Location (Zv9):
Chromosome 21 (position 25024529)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCATCAGCTACCATTACGTGCGGCGTACCAGACAGGTCACGCGCTAC[C/T]GAAATGGAGATGCCTATACAACAACGCAGGTGTACCATGAAAGGGTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39330
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110705 Nonsense 252 486 1 3
ENSDART00000145091 Nonsense 306 598 1 1
Genomic Location (Zv9):
Chromosome 21 (position 25024854)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25608191
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTAAAAAATGTTGACTTTCGAGAACATATGCTAGCATTCCCTGACCCTT[T/A]ACACCCACCCTGGTACACCCGTCGTTGGGTATACTGGTTGGCCTCAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37318
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110705 Nonsense 445 486 3 3
ENSDART00000145091 Nonsense 548 598 1 1
Genomic Location (Zv9):
Chromosome 21 (position 25025579)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25608916
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGGGTGTGTTAGAGAGTGAAGGGCTAGAAGATGAAGATGTAGAGGAG[A/T]GAAGCCAGGAACAAGTGGAGGAGAGAGAAAATGTAGAGACCAGGGAGGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link