si:dkey-175m17.8

Ensembl ID:
ENSDARG00000079905
ZFIN ID:
ZDB-GENE-030131-4145
Human Orthologue:
MARK2
Human Description:
MAP/microtubule affinity-regulating kinase 2 [Source:HGNC Symbol;Acc:3332]
Mouse Orthologue:
Mark2
Mouse Description:
MAP/microtubule affinity-regulating kinase 2 Gene [Source:MGI Symbol;Acc:MGI:99638]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1844 Essential Splice Site Available for shipment Available now
sa23953 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1844
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040754 Essential Splice Site 247 768 8 19
ENSDART00000137667   None 109 None 6
ENSDART00000138266   None 243 None 6
ENSDART00000143239 Essential Splice Site 247 736 8 18
ENSDART00000146959   None 139 None 3
ENSDART00000147589   None 140 None 7

The following transcripts of ENSDARG00000079905 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 26623051)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27191962
KASP Assay ID:
554-1835.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACACACTGGTCAGTGGTTCTTTGCCGTTCGATGGACAGAACCTAAAGG[T/C]GAGCATTGCGAAATGAGAGTAATTGTYAGTATKTTTACAWTTTTATATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23953
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040754 Essential Splice Site 321 768 None 19
ENSDART00000137667   None 109 None 6
ENSDART00000138266   None 243 None 6
ENSDART00000143239   322 736 10 18
ENSDART00000146959   None 139 None 3
ENSDART00000147589   None 140 None 7

The following transcripts of ENSDARG00000079905 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 26619213)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27188124
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCCTACATCGAACCCCAGCCTGACTACAAGGACCCTAAGAGGACAGG[T/C]CAGCACCCCAGCAGTGCAGGGGGTTGGAAGAGAGGTGGGGCAGACGCGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link