si:ch73-343l4.2

Ensembl ID:
ENSDARG00000079903
ZFIN ID:
ZDB-GENE-090313-154
Description:
Novel lectin C-type domain containing protein [Source:UniProtKB/TrEMBL;Acc:B8JM25]
Human Orthologues:
CD207, CD209, CLEC4F, CLEC4M, FCER2
Human Descriptions:
C-type lectin domain family 4, member F [Source:HGNC Symbol;Acc:25357]
C-type lectin domain family 4, member M [Source:HGNC Symbol;Acc:13523]
CD207 molecule, langerin [Source:HGNC Symbol;Acc:17935]
CD209 molecule [Source:HGNC Symbol;Acc:1641]
Fc fragment of IgE, low affinity II, receptor for (CD23) [Source:HGNC Symbol;Acc:3612]
Mouse Orthologues:
Cd207, Cd209a, Cd209b, Cd209c, Cd209d, Cd209e, Cd209f, Cd209g, Clec4f, Fcer2a
Mouse Descriptions:
C-type lectin domain family 4, member f Gene [Source:MGI Symbol;Acc:MGI:1859834]
CD207 antigen Gene [Source:MGI Symbol;Acc:MGI:2180021]
CD209a antigen Gene [Source:MGI Symbol;Acc:MGI:2157942]
CD209b antigen Gene [Source:MGI Symbol;Acc:MGI:1916415]
CD209c antigen Gene [Source:MGI Symbol;Acc:MGI:2157945]
CD209d antigen Gene [Source:MGI Symbol;Acc:MGI:2157947]
CD209e antigen Gene [Source:MGI Symbol;Acc:MGI:2157948]
CD209f antigen Gene [Source:MGI Symbol;Acc:MGI:1916392]
CD209g antigen Gene [Source:MGI Symbol;Acc:MGI:1917442]
Fc receptor, IgE, low affinity II, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:95497]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18347 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18347
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113302 Essential Splice Site 147 263 2 5
ENSDART00000142371 Essential Splice Site 160 276 2 5
Genomic Location (Zv9):
Chromosome 1 (position 56397905)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55263651
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGTCACGTCATTGAGTGCTGAACTGAAGGAGGCTCGTTCTAAATCAG[G/A]TCAGTGCTGATCTGATTATAGTAGTTTCTTTATACTTTGCAAACAGTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link