si:ch73-15n24.1

Ensembl ID:
ENSDARG00000079901
ZFIN ID:
ZDB-GENE-030131-1323
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WWA3]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36785 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36785
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109810 Nonsense 120 127 4 4
ENSDART00000113948   None 139 None 5
ENSDART00000132255   None 195 None 8
ENSDART00000144299   None 272 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 9928582)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9387121
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAGTAGCTCAGATATATTTCATCCTTGGAACTATAACTCTTGGTTCT[G/T]AAAGATTCAAGCGGTTTAACAGGTATCTGTTATTAAACAGTCAAAAGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link