shroom4
- Ensembl ID:
- ENSDARG00000079900
- ZFIN ID:
- ZDB-GENE-041111-246
- Description:
- Wu:fe05h01 [Source:UniProtKB/TrEMBL;Acc:B3DGK9]
- Human Orthologue:
- SHROOM4
- Human Description:
- shroom family member 4 [Source:HGNC Symbol;Acc:29215]
- Mouse Orthologue:
- Shroom4
- Mouse Description:
- shroom family member 4 Gene [Source:MGI Symbol;Acc:MGI:2685570]
Alleles
There are 6 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa34061 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa20931 |
Nonsense |
Available for shipment |
Available now |
sa20932 |
Nonsense |
Available for shipment |
Available now |
sa11547 |
Nonsense |
Available for shipment |
Available now |
sa40883 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa38609 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa34061
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000111542 |
Nonsense |
51 |
1634 |
2 |
10 |
- Genomic Location (Zv9):
- Chromosome 7 (position 25938887)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
7 |
24500639 |
GRCz11 |
7 |
24771796 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTAAACTGTCTCTCCTATAGATAGAAGAGGGAGGAAAAGCAGCTCAGTG[T/A]AAGAAGTTGAGAGTGGGGGATGAACTGGTGAACATCAACGGCTCTGCTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20931
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000111542 |
Nonsense |
357 |
1634 |
4 |
10 |
- Genomic Location (Zv9):
- Chromosome 7 (position 25961491)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
7 |
24523243 |
GRCz11 |
7 |
24794400 |
- KASP Assay ID:
- 2259-8799.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATACAAGACAGTGAGCCAGAGCGTAAAGGGTGCAGCATTCAACCTTATTA[T/A]ACCTTGAACTCAGACTCAGGTGGAGATGGCAAAGCAACTGACCATGAGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20932
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000111542 |
Nonsense |
842 |
1634 |
4 |
10 |
- Genomic Location (Zv9):
- Chromosome 7 (position 25962944)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
7 |
24524696 |
GRCz11 |
7 |
24795853 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAGGGAAAGAGAGCAGGAGAGACTTAAGGAGCAAGAGAAGCTTAGAGAA[C/T]AAGAAAGAGAAAAGGAGAGGTTAAGGAAAGAGAGGGAAAATGAGCAACAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11547
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000111542 |
Nonsense |
968 |
1634 |
5 |
10 |
- Genomic Location (Zv9):
- Chromosome 7 (position 25967377)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
7 |
24529129 |
GRCz11 |
7 |
24800286 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TAGTTWTTTTGTTKTTTAAAATATRSCAAATATATTTTACAGGCCCAGTA[T/A]GTTCGGGAACAGGAAAAAACKAGAAARATCAACAGAAACTTCAGCTTAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40883
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000111542 |
Nonsense |
1449 |
1634 |
8 |
10 |
- Genomic Location (Zv9):
- Chromosome 7 (position 25975028)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
7 |
24536780 |
GRCz11 |
7 |
24807937 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGCTTAGAGAGATCTCAGAGAGGAAAGAGGAAGATGAGGAGCTCAATTA[T/A]AAGGTGAAAGACCCATCATTGTATAATTCACTTGTTACATTCTTTGTGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38609
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000111542 |
Nonsense |
1584 |
1634 |
10 |
10 |
- Genomic Location (Zv9):
- Chromosome 7 (position 25978653)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
7 |
24540405 |
GRCz11 |
7 |
24811562 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGCGCGAGCAGGCCGTCTGCAGAGTGCTGGGATGCTGCCTGACCCCAGAA[C/T]AGATGCGGGACTACGGTCACTTTGTGAAGATGAAGGCGGCGCTACTGGTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: