LOC100003594

Ensembl ID:
ENSDARG00000079899
Human Orthologue:
FAM135B
Human Description:
family with sequence similarity 135, member B [Source:HGNC Symbol;Acc:28029]
Mouse Orthologue:
Fam135b
Mouse Description:
family with sequence similarity 135, member B Gene [Source:MGI Symbol;Acc:MGI:1917613]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31030 Nonsense Mutation detected in F1 DNA During 2016
sa43206 Nonsense Mutation detected in F1 DNA During 2016
sa14366 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31030
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083635 Nonsense 1068 1475 12 19
ENSDART00000083635 Nonsense 1068 1475 12 19
Genomic Location (Zv9):
Chromosome 19 (position 4616275)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150230.1 111322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCCAATGAGAAAGAAAGGCCTGCTGATCCCATTGAGCCTCCAACCAAT[G/T]AGAGAGATCAGCAAATTTTAGAGGGACAGAGCAGAATCAATAAAGTGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43206
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083635 Nonsense 1068 1475 12 19
ENSDART00000083635 Nonsense 1068 1475 12 19
Genomic Location (Zv9):
Chromosome 19 (position 4616275)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150230.1 111322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCCAATGAGAAAGAAAGGCCTGCTGATCCCATTGAGCCTCCAACCAAT[G/T]AGAGAGATCAGCAAATTTTAGAGGGACAGAGCAGAATCAATAAAGTGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14366
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083635 Nonsense 1363 1475 17 19
Genomic Location (Zv9):
Chromosome 19 (position 4621824)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150230.1 116871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCAGCTCACGTTCAGAGATCACACCGACCCRCGACAGACCTTCCTCTA[C/A]ACGCTCAGCAAAAAACCAGGTACAGGCACGTGGATAAATAAGCAAGGRTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link