LOC100003594

Ensembl ID:
ENSDARG00000079899
Human Orthologue:
FAM135B
Human Description:
family with sequence similarity 135, member B [Source:HGNC Symbol;Acc:28029]
Mouse Orthologue:
Fam135b
Mouse Description:
family with sequence similarity 135, member B Gene [Source:MGI Symbol;Acc:MGI:1917613]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14366 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14366
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083635 Nonsense 1363 1475 17 19
Genomic Location:
Chromosome 19 (position 4621824)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCAGCTCACGTTCAGAGATCACACCGACCCRCGACAGACCTTCCTCTA[C/A]ACGCTCAGCAAAAAACCAGGTACAGGCACGTGGATAAATAAGCAAGGRTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z8daix5x