LOC796009

Ensembl ID:
ENSDARG00000079897
Human Orthologue:
AL035685.2
Mouse Orthologue:
Gm106
Mouse Description:
predicted gene 106 Gene [Source:MGI Symbol;Acc:MGI:2684952]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33953 Nonsense Mutation detected in F1 DNA During 2017
sa26820 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33953
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114769 Nonsense 52 269 1 6
Genomic Location (Zv9):
Chromosome 6 (position 46418553)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46479487
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACCAGTCATGCATTAGTGAAGACTGGAGGAAAGATCGTTCCTTTGGA[G/T]AGTGCTATTGCGACCAGGCATGCAAGACCACATTGGACTGTTGCCACGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26820
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114769 Nonsense 218 269 5 6
Genomic Location (Zv9):
Chromosome 6 (position 46427169)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46488103
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCATCAGGTGTGTGTAGAGTGTCAACCGCCAGCACTGACCCCAGGTCAG[C/T]GATACTGCTCCGGGGATGGAGAGAACATGGGATATGACAGGTAAGAGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link