ENSDARG00000079894

Ensembl ID:
ENSDARG00000079894
Human Orthologues:
GNRHR, GNRHR2
Human Descriptions:
gonadotropin-releasing hormone (type 2) receptor 2 [Source:HGNC Symbol;Acc:16341]
gonadotropin-releasing hormone receptor [Source:HGNC Symbol;Acc:4421]
Mouse Orthologue:
Gnrhr
Mouse Description:
gonadotropin releasing hormone receptor Gene [Source:MGI Symbol;Acc:MGI:95790]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42836 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42836
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111727 Essential Splice Site 155 334 15 16
Genomic Location (Zv9):
Chromosome 16 (position 58113241)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 54515275
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTAATATTTACCTCCTCTTCTCGCTCATATATGATGGTTTTGTTGATG[G/A]TGCAGCTGTTCATCTTCCATACGGTGAAAGCGAAGAGTGTGGACTTCACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link