dnajc6

Ensembl ID:
ENSDARG00000079891
ZFIN ID:
ZDB-GENE-080104-2
Human Orthologue:
DNAJC6
Human Description:
DnaJ (Hsp40) homolog, subfamily C, member 6 [Source:HGNC Symbol;Acc:15469]
Mouse Orthologue:
Dnajc6
Mouse Description:
DnaJ (Hsp40) homolog, subfamily C, member 6 Gene [Source:MGI Symbol;Acc:MGI:1919935]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6069 Nonsense Mutation detected in F1 DNA During 2017
sa17174 Essential Splice Site Available for shipment Available now
sa17894 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6069
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112846 Nonsense 564 903 12 19
Genomic Location (Zv9):
Chromosome 6 (position 30990445)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 31311361
KASP Assay ID:
554-3970.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGGGTCCAGGTAATATGGGGCAGCCAGACCCCTTCCTGCATGCTGCA[C/T]GATCTCCGTCTCCTACAATGCAGAACATGGGCATGGGTAAGGCATGCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17174
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112846 Essential Splice Site 870 903 17 19
Genomic Location (Zv9):
Chromosome 6 (position 30977920)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 31298836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTCAAGAARGTCTACCGCAAAGCTGTGCTGGTRGTTCACCCTGACAAG[G/A]TGAGAGATGTAAATGTTTTAANAAAGGAGGATGTCTATTGTCTTTAAART
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17894
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112846 Nonsense 898 903 18 19
Genomic Location (Zv9):
Chromosome 6 (position 30975931)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 31296847
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGATTTTTATGGAACTAAATGATGCCTGGTCGGAATTTGAGAGCMAA[G/T]GACAGAAAGCTCTGTACTAAGACTTGMTGTAAATGATCACAACCAGTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link