si:ch211-244c8.3

Ensembl ID:
ENSDARG00000079889
ZFIN ID:
ZDB-GENE-091118-9
Human Orthologue:
PHLDB2
Human Description:
pleckstrin homology-like domain, family B, member 2 [Source:HGNC Symbol;Acc:29573]
Mouse Orthologue:
Phldb2
Mouse Description:
pleckstrin homology-like domain, family B, member 2 Gene [Source:MGI Symbol;Acc:MGI:2444981]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16842 Nonsense Available for shipment Available now
sa24883 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16842
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109705 Nonsense 106 1026 2 16
ENSDART00000131984 Nonsense 189 1197 3 18
Genomic Location (Zv9):
Chromosome 10 (position 36515783)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35548485
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCACCACTTTCAATACGAGTCCCTTCCCCTTACTCACCCTCCAGTAGTT[T/A]GAGCATGCCGCCATCTCCCCACCAATCAGAGCGCCCTATAAGTCCAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24883
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109705 Essential Splice Site 878 1026 13 16
ENSDART00000131984 Essential Splice Site 1029 1197 15 18
Genomic Location (Zv9):
Chromosome 10 (position 36544311)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35577013
KASP Assay ID:
554-7476.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGACTGCAGGAGGAGACCAGCAGAAGACAGAAACTAGTGGAGAGAGAG[G/A]TGAAGATACCAGACTAACCTGTTTATAGTTGCTCTAATTCAAACATTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link