ENSDARG00000079884

Ensembl ID:
ENSDARG00000079884
Human Orthologues:
TRIM50, TRIM72, TRIM73, TRIM74
Human Descriptions:
tripartite motif-containing 50 [Source:HGNC Symbol;Acc:19017]
tripartite motif-containing 72 [Source:HGNC Symbol;Acc:32671]
tripartite motif-containing 73 [Source:HGNC Symbol;Acc:18162]
tripartite motif-containing 74 [Source:HGNC Symbol;Acc:17453]
Mouse Orthologues:
Trim50, Trim72
Mouse Descriptions:
tripartite motif-containing 50 Gene [Source:MGI Symbol;Acc:MGI:2664992]
tripartite motif-containing 72 Gene [Source:MGI Symbol;Acc:MGI:3612190]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5344 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5344
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112118 Nonsense 132 428 1 8
Genomic Location:
Chromosome 6 (position 1665041)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCAGCTCCAGAATGAATCCTGTCATAGCTAGCCTTCAAGAAAAGCTCTG[T/A]CTGGTTGATAATCTGATGAATCGGGAAAAGGCCAGAGAGGCTGTGGTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pz0uzn1j