tas2r200.1

Ensembl ID:
ENSDARG00000079880
ZFIN ID:
ZDB-GENE-070917-4
Description:
taste receptor, type 2, member 200.1 [Source:RefSeq peptide;Acc:NP_001034919]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34435 Nonsense Mutation detected in F1 DNA During 2016
sa21331 Nonsense Mutation detected in F1 DNA During 2016
sa17069 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34435
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112981 Nonsense 231 320 1 1
Genomic Location:
Chromosome 8 (position 31632754)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACGGGCACTCCAGAAGAACCAGACGCAGGTGCAGGGATCCGACTCGTA[T/A]CTCTTGGTGTGCAAACTCACCATCTCTCTGGTGGGAGTTTATCTGTCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21331
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112981 Nonsense 245 320 1 1
Genomic Location:
Chromosome 8 (position 31632796)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTCGTATCTCTTGGTGTGCAAACTCACCATCTCTCTGGTGGGAGTTTA[T/A]CTGTCCACTCTATTTATGGTGGCATTGTATTTCATTATAAAGGTTTTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17069
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112981 Nonsense 295 320 1 1
Genomic Location:
Chromosome 8 (position 31632944)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGAATGACTTCAGTGCTRCTGACGGCATCAAACAGGTATCTGAAAGAY[A/T]AACTTTGGAGTCTGTTCTGTTGCAGGAAAGCAAAGGAGCCAGTTAGCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link