tas2r200.1

Ensembl ID:
ENSDARG00000079880
ZFIN ID:
ZDB-GENE-070917-4
Description:
taste receptor, type 2, member 200.1 [Source:RefSeq peptide;Acc:NP_001034919]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21331 Nonsense Mutation detected in F1 DNA During 2014
sa17069 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21331
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112981 Nonsense 245 320 1 1
Genomic Location:
Chromosome 8 (position 31632796)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTCGTATCTCTTGGTGTGCAAACTCACCATCTCTCTGGTGGGAGTTTA[T/A]CTGTCCACTCTATTTATGGTGGCATTGTATTTCATTATAAAGGTTTTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17069
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112981 Nonsense 295 320 1 1
Genomic Location:
Chromosome 8 (position 31632944)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGAATGACTTCAGTGCTRCTGACGGCATCAAACAGGTATCTGAAAGAY[A/T]AACTTTGGAGTCTGTTCTGTTGCAGGAAAGCAAAGGAGCCAGTTAGCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/azb9mptf