arid1aa

Ensembl ID:
ENSDARG00000079879
ZFIN ID:
ZDB-GENE-080220-35
Human Orthologue:
ARID1A
Human Description:
AT rich interactive domain 1A (SWI-like) [Source:HGNC Symbol;Acc:11110]
Mouse Orthologue:
Arid1a
Mouse Description:
AT rich interactive domain 1A (SWI-like) Gene [Source:MGI Symbol;Acc:MGI:1935147]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6439 Nonsense Mutation detected in F1 DNA During 2014
sa4673 Nonsense Mutation detected in F1 DNA During 2014
sa10989 Nonsense Available for shipment Available now
sa10925 Nonsense Available for shipment Available now
sa22893 Nonsense Mutation detected in F1 DNA During 2014
sa22894 Nonsense Mutation detected in F1 DNA During 2014
sa9394 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6439
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084263 Nonsense 358 2285 2 20
ENSDART00000135930 None None 1788 None 18

The following transcripts of ENSDARG00000079879 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 36381009)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGCCAGGGTTATGGKCCCCCTGGCCCTCAGAGATACCCTATGGGCATG[C/T]AAGGACGGATGCAGTACGGCCAGCAGGTCAGTGCTCTTTTTATTTAAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4673
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084263 Nonsense 903 2285 9 20
ENSDART00000135930 Nonsense 405 1788 7 18

The following transcripts of ENSDARG00000079879 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 36396319)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGGTTACCCCAATATGTCTCCTGGTCCTGGTATGATGGGTTCMGGATA[T/A]GGCCCCTCTATGAACAACATGCCTGGGATGATGAACACGCAGGGTTCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10989
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084263 Nonsense 1327 2285 18 20
ENSDART00000135930 Nonsense 830 1788 16 18
ENSDART00000084263 Nonsense 1327 2285 18 20
ENSDART00000135930 Nonsense 830 1788 16 18

The following transcripts of ENSDARG00000079879 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 36398614)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTATTTGCATTGGTTAATCTTTTTTTTTTTTTTTTTAATTCAGAACTA[C/A]AAAAGGCCAGGTGATGGCAGCTATCCTCCAGCTAAACGGCATCATGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10925
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084263 Nonsense 1327 2285 18 20
ENSDART00000135930 Nonsense 830 1788 16 18
ENSDART00000084263 Nonsense 1327 2285 18 20
ENSDART00000135930 Nonsense 830 1788 16 18

The following transcripts of ENSDARG00000079879 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 36398614)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTATTTGCATTGGTTAATCTTTTTTTTTTTTTTTTTAATTCAGAACTA[C/A]AAAAGGCCAGGTGATGGCAGCTATCCTCCAGCTAAACGGCATCATGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22893
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084263 Nonsense 1438 2285 18 20
ENSDART00000135930 Nonsense 941 1788 16 18

The following transcripts of ENSDARG00000079879 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 36398947)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGGCAGTCAAATGCAGTCTGCTCCTGATGGTCCTCAAGGTGGTATGTG[G/A]CAGGGCCGAGGTGATATGGGCTACTCCAATTACCCCAATCGTCAGGGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084263 Nonsense 1723 2285 20 20
ENSDART00000135930 Nonsense 1226 1788 18 18

The following transcripts of ENSDARG00000079879 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 36399994)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAGATGGAGAAACTGAAGAGGAAGATGAAGGGGAAGAAGTGCAGAGGT[C/A]AAAACATCAAGAACAACATGCAGCACAAGTACCTCTCCAAATAAAACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9394
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084263 Nonsense 2209 2285 20 20
ENSDART00000135930 Nonsense 1712 1788 18 18

The following transcripts of ENSDARG00000079879 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 36401451)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGGGAATCTGTTGGGCTTCTTGGAGGACAGCTTAGCGGCTACACAGTTC[C/T]AGCAGAGCCAAGGTTCCTTACTTCACATGCAGGGGTCACACTTTGAGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/srslypm5