LOC100332608

Ensembl ID:
ENSDARG00000079876
Human Orthologues:
C2CD4C, C2CD4D
Human Descriptions:
C2 calcium-dependent domain containing 4C [Source:HGNC Symbol;Acc:29417]
C2 calcium-dependent domain containing 4D [Source:HGNC Symbol;Acc:37210]
Mouse Orthologues:
C2cd4c, C2cd4d
Mouse Descriptions:
C2 calcium-dependent domain containing 4C Gene [Source:MGI Symbol;Acc:MGI:2685084]
C2 calcium-dependent domain containing 4D Gene [Source:MGI Symbol;Acc:MGI:2685505]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43833 Nonsense Mutation detected in F1 DNA During 2016
sa24162 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43833
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113168 Nonsense 148 426 1 1
Genomic Location (Zv9):
Chromosome 22 (position 22493581)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22105217
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCAATCCGCCATGTCACTTCCTTACATTCCAAAAACTCAGACTTCCTA[C/A]GGCTTTGCTACATTGATGGAGAGTCCCCACACCCGGCGGAAAGAGTCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24162
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113168 Nonsense 168 426 1 1
Genomic Location (Zv9):
Chromosome 22 (position 22493521)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22105157
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTGATGGAGAGTCCCCACACCCGGCGGAAAGAGTCCCTCTTCCACTG[T/A]GACCACACAAGCCCAGTAACATCACCCAACACCCAACGCAAGTCCCAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link