si:dkey-15i8.2

Ensembl ID:
ENSDARG00000079872
ZFIN ID:
ZDB-GENE-070912-385
Description:
Novel protein similar to vertebrate Rap guanine nucleotide exchange factor (GEF) 3 (RAPGEF3) [Source
Human Orthologue:
RAPGEF4
Human Description:
Rap guanine nucleotide exchange factor (GEF) 4 [Source:HGNC Symbol;Acc:16626]
Mouse Orthologue:
Rapgef4
Mouse Description:
Rap guanine nucleotide exchange factor (GEF) 4 Gene [Source:MGI Symbol;Acc:MGI:1917723]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13883 Essential Splice Site Available for shipment Available now
sa13695 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13883
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113825 Essential Splice Site 119 248 3 8
ENSDART00000115138   None 470 None 14
ENSDART00000144046 Essential Splice Site 843 972 24 29
ENSDART00000113825 Essential Splice Site 119 248 3 8
ENSDART00000115138   None 470 None 14
ENSDART00000144046 Essential Splice Site 843 972 24 29
Genomic Location (Zv9):
Chromosome 9 (position 2953895)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 2949367
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGGGTCTGGGAAACCCTGCGGTCTGTAGACTCAGTCAGACATGGGAGG[T/G]AAGTGTTCCCACACACACACACACACACACACACACACACACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13695
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113825 Essential Splice Site 119 248 3 8
ENSDART00000115138   None 470 None 14
ENSDART00000144046 Essential Splice Site 843 972 24 29
ENSDART00000113825 Essential Splice Site 119 248 3 8
ENSDART00000115138   None 470 None 14
ENSDART00000144046 Essential Splice Site 843 972 24 29
Genomic Location (Zv9):
Chromosome 9 (position 2953895)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 2949367
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGGGTCTGGGAAACCCTGCGGTCTGTAGACTCAGTCAGACATGGGAGG[T/G]AAGTGTTCCCACACACACACACACACACACACACACACACACACACACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link