si:ch211-218o21.4

Ensembl ID:
ENSDARG00000079869
ZFIN ID:
ZDB-GENE-081104-178
Description:
Novel protein similar to vertebrate family with sequence similarity 107, member B (FAM107B) [Source:
Human Orthologue:
FAM107A
Human Description:
family with sequence similarity 107, member A [Source:HGNC Symbol;Acc:30827]
Mouse Orthologue:
Fam107a
Mouse Description:
family with sequence similarity 107, member A Gene [Source:MGI Symbol;Acc:MGI:3041256]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7146 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7146
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111513 Nonsense 53 188 1 4
ENSDART00000135155 Nonsense 53 188 2 5
Genomic Location (Zv9):
Chromosome 8 (position 38166742)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 37022157
KASP Assay ID:
554-5247.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCACAGCCYCGAGCCAAGTCCACCTCAGACACAGTTCATTGCGGTTCTT[T/A]GCATCATCATGGCCATAATCGAGGTGYGTTGCCATGCTATTTTTTACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link