LOC562316

Ensembl ID:
ENSDARG00000079862
Human Orthologue:
KL
Human Description:
klotho [Source:HGNC Symbol;Acc:6344]
Mouse Orthologue:
Kl
Mouse Description:
klotho Gene [Source:MGI Symbol;Acc:MGI:1101771]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12515 Nonsense Available for shipment Available now
sa18644 Nonsense Available for shipment Available now
sa41699 Nonsense Mutation detected in F1 DNA During 2016
sa41700 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12515
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114703 Nonsense 7 970 1 5
Genomic Location (Zv9):
Chromosome 10 (position 35039061)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 34066919
KASP Assay ID:
2260-3462.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TSGTTTTGTTCTGTCAATTTCAGGGCACAGCATCTGATCCAGGAGCAGGA[C/T]AGCACACATGGGACACATTCAGCAAACTTCCATATCCCGACGACAAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18644
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114703 Nonsense 286 970 2 5
Genomic Location (Zv9):
Chromosome 10 (position 35042398)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 34070256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTTTGTGCTTGGCTGGTTYGCCCGTCCCTTGTTTGTAGATGGAGATTA[T/A]CCACCCTGCATGAARRACAATCTGACCCACAGACTGCCGTCCTTCACCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41699
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114703 Nonsense 415 970 3 5
Genomic Location (Zv9):
Chromosome 10 (position 35044287)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 34072145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAATGTGATTGGCTACACGGCCTGGTCTCTGCTGGATGGATATGAGTG[G/A]TACCGTGAATATGCGATACGCAGAGGGCTGTTCTATGTGGATTTCAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41700
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114703 Nonsense 731 970 4 5
Genomic Location (Zv9):
Chromosome 10 (position 35047049)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 34074907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATTTTCGGTAAAGGCGATTACCCGGCGGTGATGCGTAGCTGGCTCCAA[C/T]AGAGGAACACTATTGATCTTTTCAACTACCACTTACCTACGTTCAGCGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link