LOC793832

Ensembl ID:
ENSDARG00000079857
Human Orthologue:
KIAA1841
Human Description:
KIAA1841 [Source:HGNC Symbol;Acc:29387]
Mouse Orthologue:
0610010F05Rik
Mouse Description:
RIKEN cDNA 0610010F05 gene Gene [Source:MGI Symbol;Acc:MGI:1918925]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36407 Nonsense Mutation detected in F1 DNA During 2016
sa6476 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17898 Nonsense Available for shipment Available now
sa17464 Nonsense Available for shipment Available now
sa13546 Nonsense Available for shipment Available now
sa42930 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36407
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113276 Nonsense 17 735 1 21
Genomic Location (Zv9):
Chromosome 17 (position 23766072)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23919514
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGAAAGAAGAGCATTGCTTTCAGAGGAAACCGCGCATCCATCTGGAA[C/T]AGGGTAAACCGGCGGTTGGGTGTTAGCTTAGCATTTCACACGGCGACGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6476
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113276 Essential Splice Site 163 735 4 21
Genomic Location (Zv9):
Chromosome 17 (position 23770164)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23923606
KASP Assay ID:
554-4733.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATTGCAGATCCTGCCAAGAACATTGAGAAAACAGAAGAAAATAAAAG[G/A]TGAGGCACATTTACGTCAATCTAGTCATCCTGTACTAATAATTTCTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17898
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113276 Nonsense 376 735 9 21
Genomic Location (Zv9):
Chromosome 17 (position 23773756)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23927198
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACAGAGAGAAAAATCCCTTGTGTTCCAAACAAGAWCAACATAGATGCC[A/T]GAGGAAACATTGTATTCACTCACAGCAGGTTATATAAGACACTATTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17464
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113276 Nonsense 397 735 10 21
Genomic Location (Zv9):
Chromosome 17 (position 23773937)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23927379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTGTTTGTGTAGACATAAGGCCTGGGAGGTTCATGAGTATGTGAATTG[T/A]CTTTATGAAGAGTTAAAGTCATGGGTTCAGGTCTACTGGAGGATCWGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13546
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113276 Nonsense 463 735 11 21
Genomic Location (Zv9):
Chromosome 17 (position 23776520)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23929962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCATTGGAGCAGATCATAGAYGGCACGGCCTTGGTGTTTATCCTTGCTG[C/A]ARCCAGAAAGTCCTACGATTTGATCCCTCTTTYATGCCCAAGGTTTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42930
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113276 Nonsense 596 735 15 21
Genomic Location (Zv9):
Chromosome 17 (position 23778986)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23932428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGGGTCAGAGGTCACCGAGGATGAGGTTGGGGATGAAGAAGACACAT[C/A]AAAAAAACAAGGCAAGCTAAAAAATCTTACATTATTAAAAAAAATCAATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link