dchs1

Ensembl ID:
ENSDARG00000079850
ZFIN ID:
ZDB-GENE-050208-41
Description:
Dchs1 protein [Source:UniProtKB/TrEMBL;Acc:Q5CZT3]
Human Orthologue:
DCHS1
Human Description:
dachsous 1 (Drosophila) [Source:HGNC Symbol;Acc:13681]
Mouse Orthologue:
Dchs1
Mouse Description:
dachsous 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2685011]

Alleles

There are 12 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41671 Nonsense Mutation detected in F1 DNA During 2018
sa38802 Nonsense Mutation detected in F1 DNA During 2018
sa21747 Nonsense Available for shipment Available now
sa34916 Nonsense Mutation detected in F1 DNA During 2018
sa44724 Nonsense Mutation detected in F1 DNA During 2018
sa34915 Nonsense Mutation detected in F1 DNA During 2018
sa31782 Nonsense Available for shipment Available now
sa10621 Nonsense Available for shipment Available now
sa41670 Essential Splice Site Mutation detected in F1 DNA During 2018
sa34914 Nonsense Mutation detected in F1 DNA During 2018
sa21746 Essential Splice Site Available for shipment Available now
sa41669 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41671
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108798   None 274 None 3
ENSDART00000128894 Nonsense 917 3286 7 23
ENSDART00000147790   None 921 None 2
Genomic Location (Zv9):
Chromosome 10 (position 26931625)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26335482
GRCz11 10 26297195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCGGGTCCTAATGGGCAACTAAGCTTCGACTTGATTTCCTCCGGAGGA[C/T]AGCGCACGTTTGGTGTGGAGCGTAGCAGTGGTGAAGTCCGGTTAATTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38802
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108798   None 274 None 3
ENSDART00000128894 Nonsense 943 3286 7 23
ENSDART00000147790   None 921 None 2
Genomic Location (Zv9):
Chromosome 10 (position 26931545)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26335402
GRCz11 10 26297115
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGAAGTCCGGTTAATTGGGAGTTTGTCGTACGATAGCGTACCTCGCTA[T/G]GACCTCCAAGTTATTGCCAAAGACAGTGGTGCTCCTCAACTTAGTGCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21747
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108798   None 274 None 3
ENSDART00000128894 Nonsense 1344 3286 12 23
ENSDART00000147790   None 921 None 2
Genomic Location (Zv9):
Chromosome 10 (position 26922650)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26326507
GRCz11 10 26288220
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTCTGTTATCGGCTCGGTTAGAGCACATGACCAACGTGAAGTGACCT[T/A]AAACGGTCAGGTGACCTACTTAGTAGTCGGCGGCACAGACCACGAAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108798   None 274 None 3
ENSDART00000128894 Nonsense 1379 3286 12 23
ENSDART00000147790   None 921 None 2
Genomic Location (Zv9):
Chromosome 10 (position 26922544)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26326401
GRCz11 10 26288114
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTTGACCGTCTGACAGGAGATGTTTACTTGGCTAGAGAGCTGGACTA[T/A]GAAAAAGGGTCACGGTACACCCTACAGATCGAGGTGGATGATTTCTCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44724
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108798   None 274 None 3
ENSDART00000128894 Nonsense 1518 3286 12 23
ENSDART00000147790   None 921 None 2
Genomic Location (Zv9):
Chromosome 10 (position 26922129)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26325986
GRCz11 10 26287699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATTCTGCATTGGATCCCAATCAGAGGCTTTGGGGCTCGGTGACGGCA[C/T]GAGTGTTTGTGACAGATGAAAATGACAATGCTCCGATATTCAGCTCTCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34915
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108798   None 274 None 3
ENSDART00000128894 Nonsense 1563 3286 12 23
ENSDART00000147790   None 921 None 2
Genomic Location (Zv9):
Chromosome 10 (position 26921994)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26325851
GRCz11 10 26287564
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTGTGCTGCTGTATGTCATGGCCTGGGACGCAGACCAGGGTGAAAAC[G/T]GACGGGTGTCCTACAGAATCCAGTCAGGAAACACAGCGGGACGGTTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31782
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108798   None 274 None 3
ENSDART00000128894 Nonsense 1637 3286 13 23
ENSDART00000147790   None 921 None 2
Genomic Location (Zv9):
Chromosome 10 (position 26919754)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26323611
GRCz11 10 26285324
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGTCCATCCAGGTGATTGACGTAAATGATGAAGCTCCATGGTTTGAA[C/T]GAAATGAGTTTGAAGCCCAAATCAGGGAAAACCAGCCTGCAGGGACAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10621
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108798   None 274 None 3
ENSDART00000128894 Nonsense 2031 3286 16 23
ENSDART00000147790   None 921 None 2
Genomic Location (Zv9):
Chromosome 10 (position 26913427)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26317284
GRCz11 10 26278997
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACCCAGCGCACCCTCATTGTGGAGGCTATGGACCAGGGCAGCCCYCCT[C/T]AGTCTTCTCTAGGGGTGGTGATCATATATGTGAAGGAGCAAGATTAYAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41670
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108798   None 274 None 3
ENSDART00000128894 Essential Splice Site 2065 3286 16 23
ENSDART00000147790   None 921 None 2
Genomic Location (Zv9):
Chromosome 10 (position 26913323)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26317180
GRCz11 10 26278893
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCGATTCTCACGCACCGCTAGAGATGTTAGCTTACAGGAGAACGCAGA[T/C]AAAGGTAAGTTGGCATCCTAAAGTAAAAGATTACAGAAAAAATTGTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34914
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108798   None 274 None 3
ENSDART00000128894 Nonsense 2327 3286 21 23
ENSDART00000147790   None 921 None 2
Genomic Location (Zv9):
Chromosome 10 (position 26908530)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26312387
GRCz11 10 26274100
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGGCCGTGTGTCTCTGACAGCTCCTTTGGACTATGAGGAAAGGACATG[G/A]TACAAGTTGACTATTCGAGCTTCAGATTCCAAGCACCAGAGTGAAGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21746
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108798   None 274 None 3
ENSDART00000128894 Essential Splice Site 2412 3286 22 23
ENSDART00000147790 Essential Splice Site 47 921 1 2
Genomic Location (Zv9):
Chromosome 10 (position 26907919)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26311776
GRCz11 10 26273489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGAGTGTTGTCTTCAACGCGGGATGGGTTTTACGTTGACCCTAAAAATG[G/T]TATAAGCCCAACCATTATACTAAACATCCTGATTGTTTTGGCAGTGGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41669
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108798   None 274 None 3
ENSDART00000128894 Nonsense 2618 3286 23 23
ENSDART00000147790 Nonsense 253 921 2 2
Genomic Location (Zv9):
Chromosome 10 (position 26906969)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26310826
GRCz11 10 26272539
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGTGACTGCAACGGATCCTGATTCAGCTCCCTACGCAGAGGTCCAGTA[C/A]AGCATCAGCTCTGGAGATGATATGAAGCTGTTCTCTGTGGATCAGTGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link