ENSDARG00000079843

Ensembl ID:
ENSDARG00000079843
Human Orthologues:
AC009958.4, AC110080.2, AC110080.4, AC110080.7, AC110080.8, AC233264.1, AC233264.4, AC233264.6, AC233264.7, IGKC
Human Descriptions:
Ig kappa chain V-II region Cum [Source:UniProtKB/Swiss-Prot;Acc:P01614]
Ig kappa chain V-II region RPMI 6410 [Source:UniProtKB/Swiss-Prot;Acc:P06310]
immunoglobulin kappa constant [Source:HGNC Symbol;Acc:5716]
Mouse Orthologues:
AC140374.1, Gm10878, Gm16634, Gm16688, Gm16797, Gm16798, Gm16800, Gm16904, Gm16955, Gm4964, Gm4965, Gm5153, Gm5572, Gm6827, Gm6832, Igk-V
Mouse Descriptions:
immunoglobulin kappa chain complex variable region Complex/Cluster/Region [Source:MGI Symbol;Acc:MGI
predicted gene 10878 Gene [Source:MGI Symbol;Acc:MGI:3642626]
predicted gene 4964 Gene [Source:MGI Symbol;Acc:MGI:3819952]
predicted gene 4965 Gene [Source:MGI Symbol;Acc:MGI:3648800]
predicted gene 5153 Gene [Source:MGI Symbol;Acc:MGI:3644894]
predicted gene 5572 Gene [Source:MGI Symbol;Acc:MGI:3647785]
predicted gene 6827 Gene [Source:MGI Symbol;Acc:MGI:3648380]
predicted gene 6832 Gene [Source:MGI Symbol;Acc:MGI:3645551]
predicted gene, 16634 Gene [Source:MGI Symbol;Acc:MGI:4439558]
predicted gene, 16688 Gene [Source:MGI Symbol;Acc:MGI:4439612]
predicted gene, 16797 Gene [Source:MGI Symbol;Acc:MGI:4439721]
predicted gene, 16798 Gene [Source:MGI Symbol;Acc:MGI:4439722]
predicted gene, 16800 Gene [Source:MGI Symbol;Acc:MGI:4439724]
predicted gene, 16904 Gene [Source:MGI Symbol;Acc:MGI:4439828]
predicted gene, 16955 Gene [Source:MGI Symbol;Acc:MGI:4439879]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24736 Essential Splice Site Available for shipment Available now
sa24735 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24736
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086474   None 145 None 2
ENSDART00000086737 Essential Splice Site 24 264 2 6
ENSDART00000128285   None 153 None 3
Genomic Location (Zv9):
Chromosome 25 (position 38297856)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36719833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATATGTTGTTGTTTTCATAATTTTAATAAGAGTATTGTGTAATAAGG[T/G]GACTTTTCTCTCTTCTTCAGGATCATCAGGAGTCACTTTAACTCAACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24735
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086474 Essential Splice Site 41 145 2 2
ENSDART00000086737   None 264 None 6
ENSDART00000128285   None 153 None 3
Genomic Location (Zv9):
Chromosome 25 (position 38297837)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36719852
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATTTTAATAAGAGTATTGTGTAATAAGGTGACTTTTCTCTCTTCTTC[A/G]GGATCATCAGGAGTCACTTTAACTCAACCTGAAGTTAAAACTGTCCAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link