ENSDARG00000079843

Ensembl ID:
ENSDARG00000079843
Human Orthologues:
AC009958.4, AC110080.2, AC110080.4, AC110080.7, AC110080.8, AC233264.1, AC233264.4, AC233264.6, AC233264.7, IGKC
Human Descriptions:
Ig kappa chain V-II region Cum [Source:UniProtKB/Swiss-Prot;Acc:P01614]
Ig kappa chain V-II region RPMI 6410 [Source:UniProtKB/Swiss-Prot;Acc:P06310]
immunoglobulin kappa constant [Source:HGNC Symbol;Acc:5716]
Mouse Orthologues:
AC140374.1, Gm10878, Gm16634, Gm16688, Gm16797, Gm16798, Gm16800, Gm16904, Gm16955, Gm4964, Gm4965, Gm5153, Gm5572, Gm6827, Gm6832, Igk-V
Mouse Descriptions:
immunoglobulin kappa chain complex variable region Complex/Cluster/Region [Source:MGI Symbol;Acc:MGI
predicted gene 10878 Gene [Source:MGI Symbol;Acc:MGI:3642626]
predicted gene 4964 Gene [Source:MGI Symbol;Acc:MGI:3819952]
predicted gene 4965 Gene [Source:MGI Symbol;Acc:MGI:3648800]
predicted gene 5153 Gene [Source:MGI Symbol;Acc:MGI:3644894]
predicted gene 5572 Gene [Source:MGI Symbol;Acc:MGI:3647785]
predicted gene 6827 Gene [Source:MGI Symbol;Acc:MGI:3648380]
predicted gene 6832 Gene [Source:MGI Symbol;Acc:MGI:3645551]
predicted gene, 16634 Gene [Source:MGI Symbol;Acc:MGI:4439558]
predicted gene, 16688 Gene [Source:MGI Symbol;Acc:MGI:4439612]
predicted gene, 16797 Gene [Source:MGI Symbol;Acc:MGI:4439721]
predicted gene, 16798 Gene [Source:MGI Symbol;Acc:MGI:4439722]
predicted gene, 16800 Gene [Source:MGI Symbol;Acc:MGI:4439724]
predicted gene, 16904 Gene [Source:MGI Symbol;Acc:MGI:4439828]
predicted gene, 16955 Gene [Source:MGI Symbol;Acc:MGI:4439879]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24736 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24735 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24736
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086474 None None 145 None 2
ENSDART00000086737 Essential Splice Site 24 264 2 6
ENSDART00000128285 None None 153 None 3
Genomic Location:
Chromosome 25 (position 38297856)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATATGTTGTTGTTTTCATAATTTTAATAAGAGTATTGTGTAATAAGG[T/G]GACTTTTCTCTCTTCTTCAGGATCATCAGGAGTCACTTTAACTCAACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24735
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086474 Essential Splice Site 41 145 2 2
ENSDART00000086737 None None 264 None 6
ENSDART00000128285 None None 153 None 3
Genomic Location:
Chromosome 25 (position 38297837)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATTTTAATAAGAGTATTGTGTAATAAGGTGACTTTTCTCTCTTCTTC[A/G]GGATCATCAGGAGTCACTTTAACTCAACCTGAAGTTAAAACTGTCCAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/i4ip6iym