si:ch211-39f22.2

Ensembl ID:
ENSDARG00000079840
ZFIN ID:
ZDB-GENE-090313-115
Description:
calcium-activated potassium channel subunit alpha-1 [Source:RefSeq peptide;Acc:NP_001139072]
Human Orthologue:
KCNMA1
Human Description:
potassium large conductance calcium-activated channel, subfamily M, alpha member 1 [Source:HGNC Symb
Mouse Orthologue:
Kcnma1
Mouse Description:
potassium large conductance calcium-activated channel, subfamily M, alpha member 1 Gene [Source:MGI

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15809 Essential Splice Site Available for shipment Available now
sa16902 Nonsense Available for shipment Available now
sa22259 Essential Splice Site Available for shipment Available now
sa11910 Nonsense Available for shipment Available now
sa35448 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38929 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15809
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114192 Essential Splice Site 307 1029 10 26
ENSDART00000122557 Essential Splice Site 479 1229 13 30
ENSDART00000143200 Essential Splice Site 462 1184 13 29

The following transcripts of ENSDARG00000079840 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 16849825)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16669860
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAKRCTATTTTAAATTACCCATACTTTAATAGCTTTTCTCCTTTTTAC[A/T]GAGTGATATCTATCAAGAACTACCATCCAAAGATCAGAATAATAACAYAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16902
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114192 Nonsense 323 1029 10 26
ENSDART00000122557 Nonsense 495 1229 13 30
ENSDART00000143200 Nonsense 478 1184 13 29

The following transcripts of ENSDARG00000079840 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 16849873)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16669908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACWGAGTGATATCTATCAAGAACTACCATCCAAAGATCAGAATAATAACA[C/T]AAATGTTGCAGTACCACAACAAGGTAGGAGGTGTTTTTTGTTTTCAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22259
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114192 Essential Splice Site 419 1029 13 26
ENSDART00000122557 Essential Splice Site 591 1229 16 30
ENSDART00000143200 Essential Splice Site 574 1184 16 29

The following transcripts of ENSDARG00000079840 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 16860128)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16680163
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTAGCTAAATGTTTTTCTTCTGTACACTTAATATATTTTTGCTTTTTTC[A/T]GGCTGTGCTACGTGAAGCTCAAGTTGCTGTTGATCGCTATTGAGTACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11910
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114192 Nonsense 626 1029 18 26
ENSDART00000122557 Nonsense 798 1229 21 30
ENSDART00000143200 Nonsense 781 1184 21 29

The following transcripts of ENSDARG00000079840 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 16904489)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16724524
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCATTACCATGAGCTAAAGCCCATTGTGTTTGTGGGCTCGTTAGATTA[T/A]CTGCGAAGAGAGTGGGAAACCCTTCACAACTTCCMCAAAGTCTTCATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35448
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114192 Essential Splice Site 644 1029 18 26
ENSDART00000122557 Essential Splice Site 816 1229 21 30
ENSDART00000143200 Essential Splice Site 799 1184 21 29

The following transcripts of ENSDARG00000079840 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 16904545)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16724580
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGAGTGGGAAACCCTTCACAACTTCCCCAAAGTCTTCATCTTACCTG[T/G]GAGTGCATGCATTGAACAATGAGCTGTCTGTAAATATAATGCATTCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38929
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114192 Nonsense 983 1029 26 26
ENSDART00000122557 Nonsense 1183 1229 30 30
ENSDART00000143200 Nonsense 1138 1184 29 29

The following transcripts of ENSDARG00000079840 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 16934680)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16754715
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCGTCTTCTACTTGTCTCCTGCCCTGGCTGTCTCCCAGAAAAGAGAT[G/A]GTTTACAGATGAAGCAGAAAACGCATACCCAAGGAACATTCAAATCAAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)
  • Mortality among heart failure patients: Genomic variation associated with mortality among adults of European and African ancestry with heart failure: the cohorts for heart and aging research in genomic epidemiology consortium. (View Study)
  • Obesity: Genome wide association study identifies KCNMA1 contributing to human obesity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link