MAN2C1

Ensembl ID:
ENSDARG00000079835
Description:
mannosidase, alpha, class 2C, member 1 [Source:HGNC Symbol;Acc:6827]
Human Orthologue:
MAN2C1
Human Description:
mannosidase, alpha, class 2C, member 1 [Source:HGNC Symbol;Acc:6827]
Mouse Orthologue:
Man2c1
Mouse Description:
mannosidase, alpha, class 2C, member 1 Gene [Source:MGI Symbol;Acc:MGI:1920994]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14983 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14983
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110123 Nonsense 62 1034 2 28
Genomic Location:
Chromosome 25 (position 27679089)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTGTGTTCTTGTCAGAGAAGCGCATTCCTTATTCAGAGGCAATTCAA[C/T]AAAACTTTCAGCCTTGTAAAGTTGGTGATTCATTTGGACCCACGTGAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ufd7fvgo