LOC797923

Ensembl ID:
ENSDARG00000079834
Human Orthologue:
C1orf172
Human Description:
chromosome 1 open reading frame 172 [Source:HGNC Symbol;Acc:26624]
Mouse Orthologue:
1810019J16Rik
Mouse Description:
RIKEN cDNA 1810019J16 gene Gene [Source:MGI Symbol;Acc:MGI:1916323]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1466 Nonsense Available for shipment Available now
sa14538 Nonsense Available for shipment Available now
sa17416 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114809 Nonsense 69 383 1 3
Genomic Location:
Chromosome 16 (position 58431394)
KASP Assay ID:
554-1391.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACAGACTCTCAGCTCCCTCGAAAATCWCAAACTCAATATGCMAATGGA[C/T]GAGGATCAGAAACGCTGGGCTTYATTCCCGGATCTGCAGACTCTCCTCAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa14538
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114809 Nonsense 132 383 1 3
Genomic Location:
Chromosome 16 (position 58431204)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCACGCAAACCTTGTTTACCACCAGACGAAAGCTCCACTGACAACTCTT[T/G]AAAAKCCGAACCGGAACCCAAGAAGAYCAATGGATTGATGGYATTATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17416
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114809 Nonsense 232 383 1 3
Genomic Location:
Chromosome 16 (position 58430904)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGARGATCTGGATCTGGATGATTTAGACGACGGYGGCACCGATATCGACT[C/A]GCTGATCACCAAGAAGCTTCTGGARCTTTATAAATTGCACCAGATCGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ke6bvxwu