LOC100151331

Ensembl ID:
ENSDARG00000079826
Human Orthologue:
GPR174
Human Description:
G protein-coupled receptor 174 [Source:HGNC Symbol;Acc:30245]
Mouse Orthologue:
Gpr174
Mouse Description:
G protein-coupled receptor 174 Gene [Source:MGI Symbol;Acc:MGI:2685222]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22432 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22432
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115177 Nonsense 320 327 1 1
Genomic Location:
Chromosome 14 (position 10796214)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAAGAAAGTTTTCAGTTACACCAAAGAATATTTTGCCCTACAAACCCC[G/T]AAGTCACATTTAAACCAAACAGATGAAGCAAAGATTGGAGATCACGTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nxe07aaa