si:dkey-190g11.7

Ensembl ID:
ENSDARG00000079823
ZFIN ID:
ZDB-GENE-081104-343
Description:
hypothetical protein LOC567309 [Source:RefSeq peptide;Acc:NP_001107080]
Human Orthologue:
MRPS36
Human Description:
mitochondrial ribosomal protein S36 [Source:HGNC Symbol;Acc:16631]
Mouse Orthologues:
Mrps36, Mrps36-ps1
Mouse Descriptions:
mitichondrial ribosomal protein S36, pseudogene 1 Pseudogene [Source:MGI Symbol;Acc:MGI:3809201]
mitochondrial ribosomal protein S36 Gene [Source:MGI Symbol;Acc:MGI:1913378]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38679 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38679
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113821   None 113 None 4
ENSDART00000135042 Essential Splice Site None 113 2 5
ENSDART00000143920   None 113 2 5
Genomic Location (Zv9):
Chromosome 8 (position 17685979)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17130867
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGCCCTCTAATGGTTACTAATGTATTTACTTTGTTTGAACCGGAAGCA[G/T]TGATCGGATGTCGTCATGGGAAGCAAAGTGAGTGGCAAGATGGCAGCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link